ID: 1113784515_1113784528

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1113784515 1113784528
Species Human (GRCh38) Human (GRCh38)
Location 13:112995508-112995530 13:112995537-112995559
Sequence CCACTTCTGCCCCAGGAGAGCAG GCTGGCGGCCGAGGTGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 368} {0: 1, 1: 1, 2: 5, 3: 45, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!