ID: 1113784515_1113784533

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113784515 1113784533
Species Human (GRCh38) Human (GRCh38)
Location 13:112995508-112995530 13:112995545-112995567
Sequence CCACTTCTGCCCCAGGAGAGCAG CCGAGGTGGGGTCGGTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 368} {0: 1, 1: 0, 2: 4, 3: 41, 4: 1324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!