ID: 1113786279_1113786291

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1113786279 1113786291
Species Human (GRCh38) Human (GRCh38)
Location 13:113003577-113003599 13:113003616-113003638
Sequence CCATCCTGCAGTTCCCTCCTGAA GGACCACCCTGGACAAGAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 41, 4: 383} {0: 1, 1: 0, 2: 1, 3: 24, 4: 532}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!