ID: 1113801646_1113801658

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1113801646 1113801658
Species Human (GRCh38) Human (GRCh38)
Location 13:113089712-113089734 13:113089763-113089785
Sequence CCCCGAAAAGGGCAAAGGTGGGT GCCTCACACGGAGCTGCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91} {0: 1, 1: 0, 2: 3, 3: 3, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!