|
Left Crispr |
Right Crispr |
| Crispr ID |
1113807360 |
1113807363 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:113117655-113117677
|
13:113117679-113117701
|
| Sequence |
CCGACCGCGGTGCTGGGTGGGTG |
CACTCTCCCCTGTCCGACCGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 1, 2: 0, 3: 8, 4: 111} |
{0: 3, 1: 2, 2: 0, 3: 5, 4: 62} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|