ID: 1113807360_1113807365

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1113807360 1113807365
Species Human (GRCh38) Human (GRCh38)
Location 13:113117655-113117677 13:113117685-113117707
Sequence CCGACCGCGGTGCTGGGTGGGTG CCCCTGTCCGACCGCGGTGCTGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 8, 4: 111} {0: 3, 1: 2, 2: 1, 3: 0, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!