ID: 1113809472_1113809484

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1113809472 1113809484
Species Human (GRCh38) Human (GRCh38)
Location 13:113129630-113129652 13:113129676-113129698
Sequence CCTGGCTGTTGGTAAGGAGCTCA CGCTGCTCCGTCCATCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 123} {0: 1, 1: 0, 2: 4, 3: 52, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!