ID: 1113821236_1113821241

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1113821236 1113821241
Species Human (GRCh38) Human (GRCh38)
Location 13:113214957-113214979 13:113214992-113215014
Sequence CCCATGTGGCTGTGGACATCTTG TGGAGGTTGCTGTGTGACTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 182} {0: 2, 1: 8, 2: 12, 3: 25, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!