ID: 1113821965_1113821974

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1113821965 1113821974
Species Human (GRCh38) Human (GRCh38)
Location 13:113221068-113221090 13:113221111-113221133
Sequence CCTCCTGAAGGGATGGGGAGGAT CACCAGAAGCAGAGCGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 241} {0: 1, 1: 0, 2: 1, 3: 10, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!