ID: 1113836450_1113836465

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1113836450 1113836465
Species Human (GRCh38) Human (GRCh38)
Location 13:113331265-113331287 13:113331311-113331333
Sequence CCTCATCTGAGCCACAGGATTGA ACCTGGGGGTTGGGGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 1, 1: 0, 2: 4, 3: 57, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!