ID: 1113848683_1113848695

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1113848683 1113848695
Species Human (GRCh38) Human (GRCh38)
Location 13:113405929-113405951 13:113405974-113405996
Sequence CCTGCAGCTGCCATCGCCCCACA GGTTCATTTAATGAGGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 256} {0: 1, 1: 0, 2: 1, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!