ID: 1113867194_1113867198

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1113867194 1113867198
Species Human (GRCh38) Human (GRCh38)
Location 13:113534641-113534663 13:113534676-113534698
Sequence CCAGCTGGGGCGTGGTCGCGCTC GCTGCTGGAGAGACTGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74} {0: 1, 1: 1, 2: 33, 3: 857, 4: 10171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!