ID: 1113870685_1113870692

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113870685 1113870692
Species Human (GRCh38) Human (GRCh38)
Location 13:113558104-113558126 13:113558141-113558163
Sequence CCGGGTTGAATTTCCATCTTCCG GGTTGCCCAGGCTGTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82} {0: 1, 1: 0, 2: 5, 3: 47, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!