ID: 1113880461_1113880467

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1113880461 1113880467
Species Human (GRCh38) Human (GRCh38)
Location 13:113622660-113622682 13:113622700-113622722
Sequence CCGCTTGCTTCACCAGTGTTCTG AGAGCCGCAGCCTCTGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 166} {0: 1, 1: 0, 2: 3, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!