ID: 1113883851_1113883862

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1113883851 1113883862
Species Human (GRCh38) Human (GRCh38)
Location 13:113647129-113647151 13:113647159-113647181
Sequence CCCCCGGCTTTATCAGGAAGGGG CGGGCACGGGGGTGCCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99} {0: 1, 1: 0, 2: 0, 3: 17, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!