ID: 1113884741_1113884748

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1113884741 1113884748
Species Human (GRCh38) Human (GRCh38)
Location 13:113652559-113652581 13:113652576-113652598
Sequence CCCCTTTACCTGGCCCTGGCATC GGCATCTCTGGCTGCCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 413} {0: 1, 1: 0, 2: 2, 3: 21, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!