ID: 1113885544_1113885553

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113885544 1113885553
Species Human (GRCh38) Human (GRCh38)
Location 13:113656810-113656832 13:113656859-113656881
Sequence CCAGGAGGCGGCACATGGGAGTC GGGGCTTCCAAGGACCTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102} {0: 1, 1: 0, 2: 5, 3: 25, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!