ID: 1113887702_1113887712

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1113887702 1113887712
Species Human (GRCh38) Human (GRCh38)
Location 13:113669773-113669795 13:113669812-113669834
Sequence CCTCTGTCTGGTGATGACCATCA CAGGTAAGGGCTGGGCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 102} {0: 1, 1: 0, 2: 4, 3: 47, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!