ID: 1113896315_1113896326

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1113896315 1113896326
Species Human (GRCh38) Human (GRCh38)
Location 13:113766509-113766531 13:113766542-113766564
Sequence CCCTCCATTGTCTGGGTTGGCCC CAGGGTGACCAGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180} {0: 1, 1: 0, 2: 6, 3: 69, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!