ID: 1113896568_1113896573

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1113896568 1113896573
Species Human (GRCh38) Human (GRCh38)
Location 13:113768425-113768447 13:113768441-113768463
Sequence CCAGTATCATTTTCTGCCCAGAG CCCAGAGCTGGGGCTTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193} {0: 1, 1: 0, 2: 10, 3: 73, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!