ID: 1113904444_1113904453

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1113904444 1113904453
Species Human (GRCh38) Human (GRCh38)
Location 13:113812779-113812801 13:113812819-113812841
Sequence CCGGGTGGGTCACAGGACAGGTC CCTGAGTGGGTCACAGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 151} {0: 1, 1: 0, 2: 3, 3: 22, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!