ID: 1113909253_1113909256

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1113909253 1113909256
Species Human (GRCh38) Human (GRCh38)
Location 13:113834457-113834479 13:113834481-113834503
Sequence CCAGGTCTTCACGGAAGTGTTTC CCCGAAAGCCCCCACCGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100} {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!