ID: 1113909259_1113909276

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1113909259 1113909276
Species Human (GRCh38) Human (GRCh38)
Location 13:113834489-113834511 13:113834518-113834540
Sequence CCCCCACCGGCGAGGGCCCCCGG CGTGAAGGGCCCGCGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154} {0: 1, 1: 0, 2: 0, 3: 19, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!