ID: 1113922110_1113922123

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1113922110 1113922123
Species Human (GRCh38) Human (GRCh38)
Location 13:113919096-113919118 13:113919140-113919162
Sequence CCAAGTATGAGCCCAGCCCAGCC CGACCCATTGGGTTATAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!