ID: 1113927688_1113927704

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1113927688 1113927704
Species Human (GRCh38) Human (GRCh38)
Location 13:113950688-113950710 13:113950729-113950751
Sequence CCAGGGCTGGCCCCGCCTCTCCT TTCTCCCACAGCTGGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 664} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!