ID: 1113932185_1113932193

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1113932185 1113932193
Species Human (GRCh38) Human (GRCh38)
Location 13:113974315-113974337 13:113974350-113974372
Sequence CCGGGGCTGGGGCGGGTTCTGCG CTTTCCCGCAGGCCGGGGTTGGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 1, 3: 28, 4: 322} {0: 2, 1: 4, 2: 2, 3: 13, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!