ID: 1113938724_1113938735

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1113938724 1113938735
Species Human (GRCh38) Human (GRCh38)
Location 13:114007789-114007811 13:114007822-114007844
Sequence CCCGGCACTGCCACAGAGATCTC CCGGGCTCAGGCAACACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 292} {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!