ID: 1113941657_1113941659

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1113941657 1113941659
Species Human (GRCh38) Human (GRCh38)
Location 13:114021552-114021574 13:114021572-114021594
Sequence CCGTGTGGAGCAAAGATGACAGG AGGCCACGCTTTGTTCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 206} {0: 1, 1: 0, 2: 1, 3: 4, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!