ID: 1113946935_1113946941

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1113946935 1113946941
Species Human (GRCh38) Human (GRCh38)
Location 13:114049755-114049777 13:114049768-114049790
Sequence CCCTTGGAGGCCCCTGGCAGGGG CTGGCAGGGGCTGAGAACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 268} {0: 1, 1: 0, 2: 3, 3: 42, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!