ID: 1113948241_1113948250

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1113948241 1113948250
Species Human (GRCh38) Human (GRCh38)
Location 13:114056973-114056995 13:114056992-114057014
Sequence CCCCCCCTGCTAAGAGGAGCTGT CTGTTGTCCTTGGGAACCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 830} {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!