ID: 1113960232_1113960245

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1113960232 1113960245
Species Human (GRCh38) Human (GRCh38)
Location 13:114122116-114122138 13:114122167-114122189
Sequence CCTTCCAGGCTGCGCAGCCGGCC CAGCCTTCAGGGCCCCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 257} {0: 1, 1: 0, 2: 2, 3: 17, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!