ID: 1113961518_1113961526

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1113961518 1113961526
Species Human (GRCh38) Human (GRCh38)
Location 13:114128800-114128822 13:114128820-114128842
Sequence CCCCAGCGGGGAGCCCACGGCAG CAGGCCCGGCCTCCCACGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 237} {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!