ID: 1113965777_1113965785

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1113965777 1113965785
Species Human (GRCh38) Human (GRCh38)
Location 13:114152879-114152901 13:114152895-114152917
Sequence CCCCTCAGGTTGGGCCTAATTGG TAATTGGAGCAGAATCGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63} {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!