ID: 1113981604_1113981617

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113981604 1113981617
Species Human (GRCh38) Human (GRCh38)
Location 13:114281468-114281490 13:114281517-114281539
Sequence CCAGGCTGTGTGGCCGGAGGTCA GCGCCTGACCCCTTCGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 242} {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!