ID: 1113981606_1113981617

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1113981606 1113981617
Species Human (GRCh38) Human (GRCh38)
Location 13:114281491-114281513 13:114281517-114281539
Sequence CCACCCCGACCCCGACTAGTCCC GCGCCTGACCCCTTCGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 205} {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!