ID: 1114024424_1114024425

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1114024424 1114024425
Species Human (GRCh38) Human (GRCh38)
Location 14:18511968-18511990 14:18511985-18512007
Sequence CCAGAACACTGCTGCTGTTTCTG TTTCTGTTTGTCCCTCAAAAAGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 14, 3: 125, 4: 836}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!