ID: 1114031530_1114031538

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1114031530 1114031538
Species Human (GRCh38) Human (GRCh38)
Location 14:18584240-18584262 14:18584259-18584281
Sequence CCAGTCCCTCCCTGGCGGCTGCG TGCGGAGCCGTCCGAGGACAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 5, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!