ID: 1114062957_1114062963

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1114062957 1114062963
Species Human (GRCh38) Human (GRCh38)
Location 14:19037363-19037385 14:19037397-19037419
Sequence CCGGTGCTGGAGTCCAGAGCACA TCCTCCCGTGCCATAGTGTAGGG
Strand - +
Off-target summary No data {0: 10, 1: 8, 2: 3, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!