ID: 1114073395_1114073409

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1114073395 1114073409
Species Human (GRCh38) Human (GRCh38)
Location 14:19132726-19132748 14:19132776-19132798
Sequence CCCTGAGGCGCTGGCGGTTGCAG TCCTAGTGGTGCCGGCGCCCAGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 19, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!