ID: 1114073403_1114073409

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1114073403 1114073409
Species Human (GRCh38) Human (GRCh38)
Location 14:19132751-19132773 14:19132776-19132798
Sequence CCGGGGGTCCGTTCCGAACCTCG TCCTAGTGGTGCCGGCGCCCAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 1, 3: 1, 4: 28} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!