ID: 1114080767_1114080774

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1114080767 1114080774
Species Human (GRCh38) Human (GRCh38)
Location 14:19200246-19200268 14:19200273-19200295
Sequence CCTTGGCTTCCTGGGCTGTGGCC CAGAGGACACAGAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 74, 4: 599} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!