ID: 1114107661_1114107668

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1114107661 1114107668
Species Human (GRCh38) Human (GRCh38)
Location 14:19442523-19442545 14:19442569-19442591
Sequence CCATCAAACTTCTGGATATCAGG CCTGAAGGACATTAAGTTAAAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 16, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!