ID: 1114124852_1114124853

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1114124852 1114124853
Species Human (GRCh38) Human (GRCh38)
Location 14:19713439-19713461 14:19713453-19713475
Sequence CCAGTTTGGCATAGAGATGCCCA AGATGCCCAGTCATGATATTAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 0, 3: 6, 4: 95} {0: 4, 1: 0, 2: 1, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!