ID: 1114124852_1114124859

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1114124852 1114124859
Species Human (GRCh38) Human (GRCh38)
Location 14:19713439-19713461 14:19713481-19713503
Sequence CCAGTTTGGCATAGAGATGCCCA GCAAGGGACGGCAGATAGCAAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 0, 3: 6, 4: 95} {0: 4, 1: 0, 2: 6, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!