|
Left Crispr |
Right Crispr |
| Crispr ID |
1114133153 |
1114133161 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:19816697-19816719
|
14:19816732-19816754
|
| Sequence |
CCCTGATTGCCCTGGCCAGAACT |
TTGAATAAGGATGGTGAGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 55, 1: 62, 2: 39, 3: 75, 4: 262} |
{0: 1, 1: 8, 2: 90, 3: 1149, 4: 12802} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|