ID: 1114145493_1114145494

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1114145493 1114145494
Species Human (GRCh38) Human (GRCh38)
Location 14:19972015-19972037 14:19972042-19972064
Sequence CCACTTCTGTCTTATTTAGAAGT TCTTTACGACTTATCTCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!