ID: 1114167609_1114167611

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1114167609 1114167611
Species Human (GRCh38) Human (GRCh38)
Location 14:20235888-20235910 14:20235920-20235942
Sequence CCGCCTTGCAGTTTGATCACAGA TAGCAATCAGCGAGACACCGTGG
Strand - +
Off-target summary No data {0: 5, 1: 920, 2: 1493, 3: 979, 4: 978}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!