ID: 1114186355_1114186368

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1114186355 1114186368
Species Human (GRCh38) Human (GRCh38)
Location 14:20405423-20405445 14:20405457-20405479
Sequence CCCCATCCCCTCCTTCACACCTC GATAAACTCAGGCTCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 1038} {0: 1, 1: 0, 2: 3, 3: 27, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!