ID: 1114214125_1114214127

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1114214125 1114214127
Species Human (GRCh38) Human (GRCh38)
Location 14:20642947-20642969 14:20642970-20642992
Sequence CCAGTAAAACGATGGGCCTTAAT AAGCACCTTTCTTTCCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 69, 3: 74, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!