ID: 1114237017_1114237022

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114237017 1114237022
Species Human (GRCh38) Human (GRCh38)
Location 14:20832713-20832735 14:20832734-20832756
Sequence CCTTCTGGAGTAGACAGAAAGGT GTTGGGTAATAGGCTGTGCAGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 9, 3: 26, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!